 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| Circ-CER/circRNA_100876/hsa_circ_0023404 | |||
| Gene | RNF121 | Organism | Human |
| Genome Locus | chr11:33307958-33309057:+ | Build | hg19 |
| Disease | Osteoarthritis (OA) | ICD-10 | Polyarthrosis, unspecified (M15.9) |
| DBLink | Link to database | PMID | 26931159 |
| Experimental Method | |||
| Sample Type | Cartilage and Chondrocytes | Comparison | OA cartilage was isolated from the knee joints of 20 patients undergoing total knee arthroplasty (7 men and 13 women; age range 57-73 years), and normal articular cartilage was isolated from the knee joints of 10 donors after death or from trauma patients (5 men and 5 women; age range 29-65 years) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward CTGGTGCAGTGGAAGCAGAG ReverseCGACCCTCCATTGCTCTTCT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Liu, Q, Zhang, X, Hu, X, Dai, L, Fu, X, Zhang, J, Ao, Y (2016). Circular RNA Related to the Chondrocyte ECM Regulates MMP13 Expression by Functioning as a MiR-136 'Sponge' in Human Cartilage Degradation. Sci Rep, 6:22572. | |||